Transgene detection primer set
Sequence of the primers used in this study to create the LdTopIL-GFP... | Download Table
Primers for real-time RT-PCR Gene UPL# Position Sequence GFP #78 397... | Download Table
A) 5 Ј PCR primers to the indicated regions were paired with a GFP... | Download Scientific Diagram
GFP expression plasmids. (A) Location of the primers used to amplify... | Download Scientific Diagram
PCR Amplification of the Green Fluorescence Protein Gene for Sub-Cloning
Primers used in analysis of genes gfp, DsRed, and hyg and in thermal... | Download Table
List of primers used for RT-qPCR and GFP fusion constructs. | Download Table
List of primers used for RT-qPCR and GFP fusion constructs. | Download Table
AB Vector - pVL-GFP
Design and construction of the egfp-mexB fusion gene and their primers.... | Download Scientific Diagram
List of forward primers for the ®rst PCR used to generate linear... | Download Table
Primers Used for PCR Amplification of Prolamine cDNA Sequences and for... | Download Table
Primers for real-time RT-PCR Gene UPL# Position Sequence GFP #78 397... | Download Table
Primers used for generating probes for scRT-PCR in GFP-expressing... | Download Table
Supplemental Table 1. List of primers used. PrimerID Sequence Description Genotyping Primers JB8046 ACCCAACACCCGTGCGTTTTATT Intr
Primers for whole gene synthesis of superfolder GFP. | Download Table
Reporter gene fusions
GFP expression plasmids. (A) Location of the primers used to amplify... | Download Scientific Diagram
PCR amplification of GFP · Benchling
Molecules | Free Full-Text | Enzyme Treatment-Free and Ligation-Independent Cloning Using Caged Primers in Polymerase Chain Reactions
Solved You would like use PCR to amplify the GFP gene from | Chegg.com
Efficient Secretion of Recombinant Proteins from Rice Suspension-Cultured Cells Modulated by the Choice of Signal Peptide | PLOS ONE
Fluorescent protein-specific primers used for the PCR assays. YFP:... | Download Table
